rs234940 chr6:2196257 A>G
- Sequence
aaacacgcagatgctatatacttg[A/G]gccacctggtggtttatttccctc
- ASB in cell types
- erythroid progenitors suprapubic skin
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 2.70 | n/a | 3.00 | |||
| suprapubic skin | 2.31 | -1.97 | 1.00 |
Items per page:
1 – 2 of 2