rs2350581 chr8:61729502 A>T
- Sequence
gcacttactctgggctattttcaa[A/T]cacctcactaggtgtcactagccc
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) TTC-1240 (Rhabdoid tumor of the kidney) GM19193 (female B-cells Lymphoblastoid Cell Lines) PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 1.44 | 0.00 | 1.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | n/a | 2.30 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.08 | 2.46 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 1.93 | -0.34 | 2.00 |
Items per page:
1 – 4 of 4