rs235282 chr21:44865646 C>T
- Sequence
acatgtggaacgagtgttcaggaa[C/T]cccgctgcaggcagggcacaaaga
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.17 | -0.35 | 1.33 | |||
| MDM(monocyte derived macrophages) | -0.48 | 1.73 | 2.00 |
Items per page:
1 – 2 of 2