rs235298 chr21:44875672 G>C
- Sequence
gccgggtaccattggaacaccaag[G/C]taatttacttgtttgctcaattgg
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -4.69 | 1.20 | 2.67 |
Items per page:
1 – 1 of 1