rs2360999 chr14:76352646 A>C
- Sequence
gaagctcaagtttctctgactata[A/C]agtggagacaataataacatctgg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.18 | 2.20 | 1.17 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP autism, comorbid depressive syndrome and alcohol dependence, hypertension (early onset hypertension), partial epilepsy, paternal transmission distortion, serum creatinine, transmission distortion