rs2369611 chr1:160482428 G>A
- Sequence
cagtactaggtaggtatcttaagt[G/A]agtgaagcaggcagggcaggccag
- ASB in cell types
- SU-DHL-10 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 0.31 | 2.12 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, infant head circumference, triglycerides, urinary albumin-to-creatinine ratio