rs2369815 chr1:192442072 G>A
- Sequence
actcttctagctcattccaggaaa[G/A]ggtgtcaggttacactgaagatca
- ASB for transcription factors
- SIX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SIX4_HUMAN | 2.92 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, diabetic retinopathy in type 2 diabetes mellitus, prostate cancer, serum creatinine, systolic blood pressure (sbp), total cholesterol change with statins