rs2374666 chr12:107134951 G>T
- Sequence
ttgacattccatcatttggtccag[G/T]ggtcatcagggctgctcaaagatt
- ASB in cell types
- foreskin keratinocyte GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -4.57 | 2.55 | 1.50 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 2.51 | -2.35 | 1.00 |
Items per page:
1 – 2 of 2