rs2378955 chr14:32006862 G>A
- Sequence
tctagtttaagcagcaagaaagac[G/A]atgacctttctcttcagtttacct
- ASB in cell types
- A549 (lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.28 | -0.10 | 1.96 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.15 | 1.07 | 1.18 |
Items per page:
1 – 2 of 2