rs2381406 chr2:143284223 A>G
- Sequence
actggagttaacatacagaagtgc[A/G]gtgagccaggctcagctgtatgga
- ASB in cell types
- EOL-1 (Acute myeloid leukemia) GM12891 (male B- cells lymphoblastoid cell line) erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| EOL-1 (Acute myeloid leukemia) | 1.88 | -1.59 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 0.63 | 0.18 | 1.17 | |||
| erythroid cells | 2.21 | -1.47 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol, total cholesterol, waist hip ratio