rs2386660 chr10:5630096 C>T
- Sequence
ccctgtatctctggcttcatcctg[C/T]agccaattaattcaaccagtatat
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) FT282 (normal human fallopian tube tissue) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -0.47 | 0.74 | 1.00 | |||
| FT282 (normal human fallopian tube tissue) | -0.52 | 2.07 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.39 | 0.60 | 1.17 |
Items per page:
1 – 3 of 3