rs239230 chr6:100657986 C>A
- Sequence
atagtgtgtctttgaaatttattc[C/A]ctcatctcaaaatcatatagtaag
- ASB in cell types
- A549 (lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.67 | 0.96 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.41 | 0.72 | 1.05 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung