rs2393593 chr6:26285455 T>C
- Sequence
caaaaccttgcgatgacgcttagc[T/C]cctcccttacccaaaccttttcca
- ASB in cell types
- K562 (myelogenous leukemia) adult erythroblasts CHL-1 (Melanoma)
- ASB for transcription factors
- KDM6A_HUMAN VEZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM6A_HUMAN | -4.99 | 2.91 | 2.00 | n/a | n/a | |||
| VEZF1_HUMAN | n/a | 1.78 | 3.00 | 0.67 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP 2 hour glucose, hdl cholesterol, height, prop taste detection threshold, total cholesterol, years of education
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cortex, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Testis, Whole_Blood