rs2399990 chr10:13704433 G>A
- Sequence
tcctccaactcccacttccctcca[G/A]ccagaccctccctcatttgtttat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) J-Lat A72
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.16 | 0.95 | 1.23 | |||
| J-Lat A72 | 1.24 | -0.01 | 1.00 |
Items per page:
1 – 2 of 2