rs240218 chr6:80004368 G>A
- Sequence
atattcctctcactgggtaggttt[G/A]ctcgggagtggctacctcccaggc
- ASB in cell types
- K562 (myelogenous leukemia) thymus-derived CD34- cells MCF7 WS8 cells
- ASB for transcription factors
- BC11B_HUMAN GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BC11B_HUMAN | n/a | 3.27 | 2.00 | n/a | n/a | |||
| GRHL2_HUMAN | 1.01 | -0.17 | 1.44 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Thyroid