rs2405231 chr20:23361602 A>C
- Sequence
gccccagaggagagcgccgcgccg[A/C]gccccgcctggcgccagttctcca
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line) MCF7 (Invasive ductal breast carcinoma) MDA-MB-453 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.14 | 0.79 | 1.99 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.56 | 0.99 | 1.13 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.81 | 0.46 | 1.18 | |||
| MDA-MB-453 (breast adenocarcinoma) | -0.77 | 1.95 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Testis