rs2415105 chr15:71103197 G>A
- Sequence
tgaaacagattatattatttttgc[G/A]agtccaaacctgcctcttgggctg
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.81 | n/a | 2.67 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, fasting insulin, height, homa-b, homa-ir, irritible bowel syndrome, mitral annular calcium, tetrology of fallot