rs2416315 chr5:113194720 A>G
- Sequence
gggaagggaaagggaaaggggaag[A/G]gaagaggcctcctgattccctatg
- ASB in cell types
- THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.29 | -0.02 | 1.77 | -0.73 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP bipolar disorder, body mass index (bmi), diastolic blood pressure (dbp), fasting insulin, homa-b, homa-ir, mitral annular calcium, triglycerides, waist hip ratio