rs241713 chr22:32987434 G>A
- Sequence
ccaagatctgattctagctccatt[G/A]ttttctcctgagaacagctcaccc
- ASB for transcription factors
- ZFHX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFHX2_HUMAN | 2.47 | -4.70 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, bipolar disorder, fasting blood glucose, neuroblastoma (brain cancer), spine bone mineral density (bmd)