rs242026 chr12:3677718 C>T
- Sequence
acccacctgtgccccttccacctg[C/T]cagctacaccttctgtggtcgaca
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | 0.89 | 3.42 | 1.75 | -2.45 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP college completion, diastolic blood pressure (dbp), infant head circumference, triglycerides change with statins, years of education