rs2426692 chr20:56796525 T>A
- Sequence
attgcacctctgttggccacagca[T/A]tgataaggagaggaagcttgtatg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- GATA3_HUMAN TLE3_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 0.20 | 2.26 | 1.67 | 2.14 | Concordant | |||
| TLE3_HUMAN | n/a | 2.79 | 3.00 | n/a | n/a | |||
| FOXA1_HUMAN | n/a | 3.01 | 3.17 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, infant head circumference, irritible bowel syndrome, lp-pla2 mass