rs243134 chr6:48657113 C>G
- Sequence
tcactctcatttgcaaaatgggta[C/G]cacagctgtaggtctcacatcctt
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | -1.69 | 2.15 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, fasting blood glucose, refractive error, total cholesterol, years of education