rs243334 chr19:4400928 T>A
- Sequence
ccatttttatttatttatttattt[T/A]ttttttgagacggagtcttgcttt
- ASB in cell types
- HEK293 (embryonic kidney) glioblastoma patient-derived cell model
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.02 | 1.00 | 2.02 | |||
| glioblastoma patient-derived cell model | 2.81 | -5.04 | 2.00 |
Items per page:
1 – 2 of 2