rs243507 chr7:148737508 G>A
- Sequence
ctgctgttctgccatttggtacag[G/A]ttaacttgttaatgtttgaagata
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN781_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN781_HUMAN | 2.41 | -1.65 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1