rs243535 chr7:148713031 A>C
- Sequence
ctttttctttatttgattttttaa[A/C]aagttccagttcccttttactaag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.27 | 0.94 | 1.06 | |||
| MDM(monocyte derived macrophages) | 2.84 | 0.49 | 2.00 |
Items per page:
1 – 2 of 2