rs243550 chr7:148698392 G>C
- Sequence
ctggtggtgtccccgacccaagca[G/C]ctcagccccgctcgcgaggtccga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) primary B-CLL cells UCLA1 hESCs
- ASB for transcription factors
- AP2C_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2C_HUMAN | 2.54 | -2.58 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1