rs2438345 chr5:90866468 T>C
- Sequence
ttgagaatcattgactataaaata[T/C]cagtaggtggcagtagaagattta
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) K562 (myelogenous leukemia) MS-1 (Small cell lung carcinoma) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.33 | 1.21 | 1.42 | 3.85 | Concordant | |||
| STAG1_HUMAN | -0.51 | 1.66 | 1.03 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
