rs244903 chr5:168486505 G>A
- Sequence
tgagacgctgatgggaggatggac[G/A]tactggtgtctgagtgctccgcgc
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) MCF7 (Invasive ductal breast carcinoma) T47D (invasive ductal carcinoma) foreskin keratinocyte
- ASB for transcription factors
- GABPA_HUMAN SPT5H_HUMAN HCFC1_HUMAN TEAD3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABPA_HUMAN | 0.10 | 1.07 | 1.64 | n/a | No Hit | |||
| SPT5H_HUMAN | 1.04 | 1.25 | 1.12 | n/a | n/a | |||
| HCFC1_HUMAN | 1.59 | 0.17 | 2.67 | n/a | n/a | |||
| TEAD3_HUMAN | 2.00 | -1.67 | 1.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, asthma, carboplatin ic50 in b lymphoblastoid cell lines, irritible bowel syndrome, partial epilepsy, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus