rs245214 chr3:45200130 C>G
- Sequence
gcaaggaagatgaatggacttcaa[C/G]acaaggaaaggctctcagggaata
- ASB in cell types
- HepG2 (hepatoblastoma) TTC-1240 (Rhabdoid tumor of the kidney) HEK293 (embryonic kidney)
- ASB for transcription factors
- TEAD3_HUMAN SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD3_HUMAN | 3.56 | -3.55 | 1.00 | n/a | n/a | |||
| SMRC1_HUMAN | -0.65 | 1.56 | 1.29 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Colon_Transverse, Esophagus_Mucosa, Skin_Sun_Exposed_Lower_leg, Thyroid