rs2459449 chr10:73909255 T>C
- Sequence
ggggagcaacatgaatcatgacgg[T/C]ccctgggaatttcctgataactaa
- ASB in cell types
- neutrophils from periferal blood GM12878 (female B-cells lymphoblastoid cell line) CD14+ monocytes RMG-1
- ASB for transcription factors
- MEF2B_HUMAN COE1_HUMAN RAD21_HUMAN ARI1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | n/a | 2.62 | 1.50 | n/a | No Hit | |||
| COE1_HUMAN | n/a | 3.15 | 1.50 | -1.00 | Weak Discordant | |||
| RAD21_HUMAN | 3.14 | -0.97 | 1.75 | n/a | n/a | |||
| ARI1A_HUMAN | -1.54 | 2.00 | 1.00 | n/a | n/a | |||
| STAT1_HUMAN | -0.74 | 1.62 | 1.80 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GRASP college completion, coronary artery disease (cad), diastolic blood pressure (dbp), hdl cholesterol, infant head circumference, ldl cholesterol, nicotine dependence (smoking), smoking cessation, systolic blood pressure (sbp), triglycerides, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Amygdala, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood