rs246173 chr16:14285979 A>G
- Sequence
gtccgtgcctgatatccaaccttc[A/G]gctatagggtggagactttttagg
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) MS-1 (Small cell lung carcinoma) neural cell
- ASB for transcription factors
- MK14_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MK14_HUMAN | -3.37 | 1.44 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1