rs246226 chr16:16042372 T>C
- Sequence
gtgaacagacagatgcaccagtta[T/C]gtacatctgcacaactgaatacta
- ASB in cell types
- BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 1.28 | -0.13 | 1.11 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, cognitive response of healthy volunteers to topiramate treatment as measure by the digit span forward cognitive test, nausea in response to topiramate treatment in healthy volunteers