rs246240 chr16:16025167 A>G
- Sequence
accagtgtttacgttatactggca[A/G]atctcttactgctggacatttagg
- ASB in cell types
- iPS-derived chondrocytes 22RV1 (prostate carcinoma)
- ASB for transcription factors
- RARA_HUMAN SSXT_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | -0.33 | 2.14 | 1.00 | n/a | No Hit | |||
| SSXT_HUMAN | -2.24 | 2.50 | 1.00 | n/a | n/a | |||
| ANDR_HUMAN | 1.93 | -0.80 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, stabilized warfarin dose, suicide attempts in major depressive disorder, suicide attempts in mood disorder patients, taste change in healthy volunteers in response to topiramate treatment (less sweet), variant creutzfeldt-jakob disease