rs2466220 chr8:22921672 C>A
- Sequence
gctctggtctcagagagtggaagc[C/A]ggatgagtcatgggcttgctgagc
- ASB in cell types
- bronchial epithelial cells
- ASB for transcription factors
- GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GRHL2_HUMAN | -0.36 | 2.53 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, arthritis including non-rheumatoid, college completion, hip bone mineral density (bmd), irritible bowel syndrome, longstanding arthritis, lp-pla2 mass, resistance to kuru in aged women despite likely exposure, rheumatoid arthritis, total cholesterol
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Pancreas, Prostate, Stomach