rs246637 chr5:143030618 T>C
- Sequence
atcatcacaaaaaaaatgagaaag[T/C]ggaggaccaaaaggttaaaagaac
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 1.79 | 0.12 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, arthritis including non-rheumatoid, hypertension (early onset hypertension), longstanding arthritis, rheumatoid arthritis, schizophrenia
GTEx eQTL Adipose_Subcutaneous, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Testis, Whole_Blood