rs2470627 chr3:5788113 A>T
- Sequence
aaattgctttgtactcttgcatct[A/T]tgtatgtgtcagatgagatcagat
- ASB in cell types
- glioblastoma cells monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | -0.02 | 1.55 | 1.33 | |||
| monocyte-derived dendritic cells | n/a | 2.55 | 2.00 |
Items per page:
1 – 2 of 2