rs247617 chr16:56956804 C>A
- Sequence
tggcaccccttaaattttgtcagg[C/A]acttgccttaccctagtcctggcc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 1.72 | -0.17 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI age-related disease endophenotypes, age-related diseases, mortality and associated endophenotypes, hdl cholesterol, high density lipoprotein cholesterol levels, ldl cholesterol, low density lipoprotein cholesterol levels, metabolic syndrome, metabolite levels (lipoprotein measures), response to fenofibrate (hdl cholesterol levels), total cholesterol levels, triglyceride levels, triglycerides
GRASP chronic kidney disease, hdl cholesterol, hdl in metabolic styndrome subjects without diabetes, ldl cholesterol, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Pancreas, Small_Intestine_Terminal_Ileum, Stomach, Thyroid