rs2479409 chr1:55038977 G>A
- Sequence
gaattctgaatgtacctatatgac[G/A]tctttgcaaacttaaaacctgaat
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 2.32 | -0.33 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI cholesterol, total, ldl cholesterol, ldl cholesterol levels, low density lipoprotein cholesterol levels, plasma proprotein convertase subtilisin/kexin type 9 levels in stable coronary artery disease, total cholesterol levels
GRASP circulating pcsk9 levels, coronary artery disease (cad), ldl cholesterol, lp-pla2 mass, rheumatoid arthritis, total cholesterol, triglycerides