rs2481670 chr1:62136155 G>A
- Sequence
aattctcctgcctcagcctcctga[G/A]tagctgagctgggattacaggctc
- ASB in cell types
- GM23338 H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23338 | n/a | 2.19 | 1.00 | |||
| H929 (plasma cell myeloma) | 2.04 | -1.84 | 1.00 |
Items per page:
1 – 2 of 2