rs2481704 chr1:62177915 T>C
- Sequence
cacaaccccttatcttaacccaga[T/C]actcctttctattgattcctagcc
- ASB in cell types
- embryonic stem cells derived definitive endoderm definitive endoderm from HUES8
- ASB for transcription factors
- GATA6_HUMAN GATA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA6_HUMAN | 1.43 | -1.51 | 1.12 | n/a | No Hit | |||
| GATA4_HUMAN | 1.89 | -0.58 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial