rs249496 chr5:102865886 C>G
- Sequence
tcacagcccctgtcattccggagt[C/G]ataaggcacccgcgcgtctagccc
- ASB in cell types
- HepG2 (hepatoblastoma) CD34+ hematopoietic stem cells-derived proerythroblasts BEAS-2B (bronchial epithelium) SK-N-SH (neuroblastoma)
- ASB for transcription factors
- TYY1_HUMAN GATA1_HUMAN GCR_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | -0.68 | 2.13 | 1.00 | n/a | No Hit | |||
| GATA1_HUMAN | n/a | 2.82 | 2.00 | 4.97 | Concordant | |||
| GCR_HUMAN | 0.27 | 1.10 | 2.00 | n/a | No Hit | |||
| JUN_HUMAN | 0.06 | 1.26 | 2.00 | -3.22 | Discordant |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, height, ldl cholesterol, salmonella-induced pyroptosis, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood