rs249817 chr12:98503132 T>A
- Sequence
catatgctatccttgaacttgaac[T/A]tcagagtgaaagtataaatttgta
- ASB in cell types
- MDA-MB-231 (breast adenocarcinoma) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-231 (breast adenocarcinoma) | 1.08 | 1.41 | 1.00 | |||
| breast tumor | 2.17 | -1.10 | 2.00 |
Items per page:
1 – 2 of 2