rs2504376 chr6:139028784 G>C
- Sequence
tttgcctcagccacttccttcctt[G/C]gcctcaccctccccagtgcactga
- ASB in cell types
- CD14+ monocytes MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- STAT1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 0.40 | 2.68 | 1.50 | n/a | No Hit | |||
| ANDR_HUMAN | -0.52 | 3.01 | 1.75 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, obesity with early age of onset (age >2), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood