rs2526354 chr17:59899297 T>C
- Sequence
tatttgacacttcttgtgtgagcc[T/C]tctagaggtaacactgagtagcag
- ASB in cell types
- K562 (myelogenous leukemia) LNCaP (prostate carcinoma) GM12878 (female B-cells lymphoblastoid cell line) CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- CTCF_HUMAN ARI1B_HUMAN RING2_HUMAN ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -3.69 | 3.94 | 1.00 | 2.70 | Concordant | |||
| ARI1B_HUMAN | n/a | 3.47 | 2.00 | n/a | n/a | |||
| RING2_HUMAN | n/a | 3.81 | 2.00 | n/a | n/a | |||
| ETS1_HUMAN | n/a | 2.84 | 1.00 | n/a | No Hit | |||
| ELF1_HUMAN | -2.71 | 2.93 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 18
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, coronary artery disease (cad), irritible bowel syndrome, juvenile idiopathic arthritis, obesity with early age of onset (age >2), type 1 diabetes, rheumatoid arthritis, crohns disease, combined case analysis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood