rs2529438 chr7:30595014 G>C
- Sequence
gctcttagcccgaccctcgctcct[G/C]ctccgccggtccctcagcgcggcc
- ASB in cell types
- 22RV1 (prostate carcinoma) neural cell
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.90 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, mitral annular calcium
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg