rs253237 chr5:66247283 C>T
- Sequence
tgttatatgcataaatacacttat[C/T]gttaaacactacactagatgtcca
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- SMRC1_HUMAN JUND_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | -2.56 | 2.48 | 1.00 | n/a | n/a | |||
| JUND_HUMAN | -0.95 | 2.10 | 1.67 | n/a | No Hit |
Items per page:
1 – 2 of 2