rs2541854 chr18:65938714 T>A
- Sequence
tgcaaccctgctaattaaagcaag[T/A]tcttgttgaaacaggtagcagtga
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 2.35 | -2.04 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.70 | 1.26 | 1.00 |
Items per page:
1 – 2 of 2