rs2546194 chr5:95857608 A>G
- Sequence
tgtgaaaatgagtggtatgggcac[A/G]tggctggtgagtcactgtggccct
- ASB in cell types
- 22RV1 (prostate carcinoma) breast tumor HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.65 | -1.21 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, comorbid depressive syndrome and alcohol dependence, late onset alzheimers disease, ldl cholesterol change with statins, suicide attempts in bipolar disorder (substance free)