rs2560761 chr6:13454915 A>G
- Sequence
atcttcagaccccaggatattagc[A/G]tcacctcctggctgtcactcacag
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.34 | 1.22 | 1.18 | 3.49 | Concordant | |||
| STAG1_HUMAN | 0.48 | 1.20 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP hdl cholesterol change with statins, homa-b, ldl cholesterol change with statins, refractive error, total cholesterol change with statins