rs257757 chr5:15824401 G>A
- Sequence
cctgactgtggcttattttctcag[G/A]tgtactcctcggcacttcccggcc
- ASB in cell types
- gastroesophageal sphincter GM18526 (B – cells Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.54 | 1.52 | 1.46 | n/a | No Hit |
Items per page:
1 – 1 of 1